I like this approach

I smell IDE

.

Beautiful!

This is not an issue! Your algorithm might need a fix. Please post it under questions tag to get help

I came for an answer, I am leaving with a life lesson

I fixed it, CH4 was formed with 2 H atoms in the Haxe trans. which is wrong. I changed the code, try it now!

I added it either way!!

Lovely to hear positive feedback!, Made the Example a bit detailed!

this RNA strand has other than 'AUCG' chars

I can give you a sample rna strand to work on.
'GCCAAUUUUAUCUCAAUUUUAAUU'
This can form a stem of length 4, but your algorithm doesn't seem to return 4

                                        U           
                                    U       A      
                    G C C A A U U           
                          | | | |              U
              U U A A U U U U A A       
                                    C       C
                                        U

I will look into your algorith anyway when I am free, and try to solve this. Cheers!!

fixed. my count didn't reset in one case where I break a loop.
Your code works perfectly now with my reference.
Ty for helping me find this issue

EDIT: I still find some problems, I am working on it
EDIT2: Fixed it, 100% working.
EDIT3: Contiguousity of stems doesn't affect the max.len of stem of all possible stems

I agree. I updated the details as per request