thank you! I'll sort this out )

Can't understand what's wrong with the code, the array was not modified, index of the smalest value is 0, any suggestions? log is below? thnx
log:
[ -495,141,151,154,159,162,173,176,226,287,288,291,310,313,314,389,408,413,429,473,491,498,525,532,537,545,563,575,611,657,676,677,685,689,703,709,727,
733,753,850,860,872,874,875,877,879,902,906,966,967 ] 'index'
✘ Expected: 39, instead got: 0

Nice one! I would rate it as 6kyu thnx

Thank you for the kata, but I just would like to note that, according to the principles of molecular biology/genetics, there is just 1 "TTTT" repeat in the sequence "GCGAACGTTATTTTTTTCGA", not 4 of them!

https://en.wikipedia.org/wiki/Tandem_repeat